ROUGE |
Gene/Protein Characteristic Table for mKIAA0189 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172910 |
---|---|
StAR-related lipid transfer protein 8 (Fragment). | |
msj09108 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2379 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1522 bp Genome contig ID gi66880665f_93571580 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
CCCTCTGCAGAATAATAAAGCAGGACTGGAGATGCFlanking genome sequence
(104511 - 104560) ----+----*----+----*----+----*----+----*----+----*
ACACTGGCTCTGGAGAGTTTGTTTTGCTGAGACAATGGGCTGGGAGCTTG
KIAA Alignment based on: KIAA0189 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..857
Length: 284 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |