| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK01962 | 
|---|---|
| Accession No | D80010 | 
| Description | lipin 1, transcript variant 1 | 
| Clone name | ha02734 | 
| Vector information | |
| cDNA sequence | DNA sequence (5307 bp) Predicted protein sequence (899 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC01962
     
     
     | 
| Flexi ORF Clone | FXC01962 | 
| Source | Myeloblast cell line (KG-1) | 
| Rouge ID | 
    mKIAA0188
    
    by Kazusa Mouse cDNA Project
     | 
 Length: 5307 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | Warning | 
 Integrity of 3' end
    | Length of 3'UTR | 2606 bp | 
|---|---|
| Genome contig ID | gi89161199f_11723109 | 
| PolyA signal sequence (AATAAA,-23)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (161868 - 161917)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
  
 Ensembl ContigView  (Add our DAS server as a DAS source)
  
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
| 
 | 2 | f | 11804230 | 11884975 | 20 | 99.5 | Perfect prediction | 
 
        Length: 899 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
 Chromosome No. 2
 Experimental conditions| Panel name | Genebridge 4 | 
|---|---|
| Primer_f | GCAAGGCTGGCATATTAACAC | 
| Primer_r | AGGGCAACTTTGAAATGTGTG | 
| PCR product length | 173 bp | 
| PCR conditions | 95 °C 15 sec 60 °C 60 sec 30 cycles |