ROUGE

Gene/Protein Characteristic Table for mKIAA0187

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129082
Description :	BMS1-like, ribosome assembly protein. ribosome biogenesis protein BMS1 homolog. EST AA408648.
Clone Name :	mpm09170 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4246 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 268 bp

Genome contig ID gi65504368r_118715971
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
TTTGTGCTATAAAAATATTAAACTATTTTCCCATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTTTGGCCTAGTGATTTATTTGGGGATGAATACATGACAGTTTGCTTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0187 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0187	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 115..3978
Length: 1287 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH57054	99.8	BMS1 homolog, r...	Mus musculus
AAH91626	99.9	Unknown (protei...	Xenopus laevis
BAE21470	99.8	unnamed protein...	Mus musculus
XP_342747	89.3	similar to BMS1...	Rattus norvegicus
XP_001057343	86.5	similar to BMS1...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129350	1e-09	25.6	mKIAA1401

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR012948 234 320 PF08142 AARP2CN

IPR007034 818 1111 PF04950 Protein of unknown function DUF663

ProfileScan NULL 442 879 PS50313 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012948	234	320	PF08142	AARP2CN
IPR007034	818	1111	PF04950	Protein of unknown function DUF663
ProfileScan	NULL	442	879	PS50313	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	268 bp
Genome contig ID	gi65504368r_118715971
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTTGTGCTATAAAAATATTAAACTATTTTCCCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTTGGCCTAGTGATTTATTTGGGGATGAATACATGACAGTTTGCTTA

Gene/Protein Characteristic Table for mKIAA0187

Features of the cloned DNA sequence

Features of the protein sequence