Order Kazusa clone(s) from : ![]() |
Product ID | ORK01058 |
---|---|
Accession No | D80009 |
Description | BMS1 ribosome biogenesis factor |
Clone name | ha02920 |
Vector information | |
cDNA sequence | DNA sequence (4181 bp) Predicted protein sequence (1285 aa) |
HaloTag ORF Clone |
FHC01058
![]() |
Flexi ORF Clone | FXC01058 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0187
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 305 bp |
---|---|
Genome contig ID | gi89161187f_42499822 |
PolyA signal sequence (ATTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (147035 - 147084) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 42599822 | 42646855 | 22 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | GCTAAGGACCAGAAGAAACAC |
Primer_r | TCCGGGCATCTTCTTCGTCTC |
PCR product length | 109 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |