ROUGE

Gene/Protein Characteristic Table for mKIAA1401

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129350
Description :
Clone Name :	mph02450 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3337 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 932 bp

Genome contig ID gi65527427f_74523785
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GACCTTGAAGCACTTTAATAAAAGTTGTATCTGAT
Flanking genome sequence
(111214 - 111263)
----+----*----+----*----+----*----+----*----+----*
AACTGGCTTGTCTGGATTCTAGTAATTGGGAAGGGCCATAGCTTTGTGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1401 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1401	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2405
Length: 800 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5SWD9	100.0	Pre-rRNA-proces...	Mus musculus
BAE32349	99.9	unnamed protein...	Mus musculus
EDM05192	94.4	rCG34104, isofo...	Rattus norvegicus
EDL12783	100.0	TSR1, 20S rRNA ...	Mus musculus
XP_001504411	86.8	TSR1, 20S rRNA ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129082	1.6e-13	24.9	mKIAA0187

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR012948 225 306 PF08142 AARP2CN

IPR007034 482 769 PF04950 Protein of unknown function DUF663

ProfileScan NULL 400 483 PS50313 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012948	225	306	PF08142	AARP2CN
IPR007034	482	769	PF04950	Protein of unknown function DUF663
ProfileScan	NULL	400	483	PS50313	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	932 bp
Genome contig ID	gi65527427f_74523785
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GACCTTGAAGCACTTTAATAAAAGTTGTATCTGAT
Flanking genome sequence (111214 - 111263)	----+--------+--------+--------+--------+----* AACTGGCTTGTCTGGATTCTAGTAATTGGGAAGGGCCATAGCTTTGTGAG

Gene/Protein Characteristic Table for mKIAA1401

Features of the cloned DNA sequence

Features of the protein sequence