ROUGE |
Gene/Protein Characteristic Table for mKIAA0185 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129080 |
---|---|
programmed cell death protein 11. programmed cell death protein 7. |
|
mpf00482 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6040 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 340 bp Genome contig ID gi65553144f_46542069 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AAGGCACATACGATCACTTTTTACTTTTAAATGTGFlanking genome sequence
(140384 - 140433) ----+----*----+----*----+----*----+----*----+----*
TGTGTGTGTGTAAAATTCTTTTTTAAAATTTAGAGTGCCACGGATGGAGC
KIAA Alignment based on: KIAA0185 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 100..5700
Length: 1866 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |