ROUGE

Gene/Protein Characteristic Table for mKIAA0178

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172908
Description :	Structural maintenance of chromosome 1-like 1 protein.
Clone Name :	msk06204 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 870 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 158 bp

Genome contig ID gi66880665f_145493192
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
GATTGTTTGCAAAATAAATATTGGAGATTGGTTTT
Flanking genome sequence
(103173 - 103222)
----+----*----+----*----+----*----+----*----+----*
AAAGGAGCCTAATCTAAATTTGATTCCAAGGGAATACAGGATAGCTGTAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0178 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0178	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..712
Length: 236 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE43202	1.7e-86	100.0	unnamed protein...	Mus musculus
AAH55477	2.2e-86	100.0	Smc1a protein [...	Mus musculus
EAW93149	3e-86	100.0	SMC1 structural...	Homo sapiens
XP_001914824	3.2e-86	100.0	similar to SMC1...	Equus caballus
EAW93151	5.2e-86	100.0	SMC1 structural...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003395 33 215 PF02463 SMC protein

ProfileScan IPR003439 131 206 PS50100 ABC transporter related

ScanRegExp IPR003439 131 145 PS00211 ABC transporter related

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003395	33	215	PF02463	SMC protein
ProfileScan	IPR003439	131	206	PS50100	ABC transporter related
ScanRegExp	IPR003439	131	145	PS00211	ABC transporter related

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	158 bp
Genome contig ID	gi66880665f_145493192
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GATTGTTTGCAAAATAAATATTGGAGATTGGTTTT
Flanking genome sequence (103173 - 103222)	----+--------+--------+--------+--------+----* AAAGGAGCCTAATCTAAATTTGATTCCAAGGGAATACAGGATAGCTGTAC

Gene/Protein Characteristic Table for mKIAA0178

Features of the cloned DNA sequence

Features of the protein sequence