Order Kazusa clone(s) from : ![]() |
Product ID | ORK04764 |
---|---|
Accession No | D63479 |
Description | diacylglycerol kinase, delta 130kDa |
Clone name | hg01767 |
Vector information | |
cDNA sequence | DNA sequence (6238 bp) Predicted protein sequence (1198 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0145
by Kazusa Mouse cDNA Project
|
Note | We replaced ha00914, former representative clones for KIAA0145 with hg01767. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2640 bp |
---|---|
Genome contig ID | gi89161199f_233827952 |
PolyA signal sequence (AATAAA,-28) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (217532 - 217581) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 233927951 | 234045482 | 30 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001206 | 306 | 401 | PD005043 | Diacylglycerol kinase |
IPR000756 | 879 | 925 | PD002939 | Diacylglycerol kinase accessory region | |
FPrintScan | IPR002219 | 161 | 170 | PR00008 | Protein kinase C |
IPR002219 | 174 | 185 | PR00008 | Protein kinase C | |
IPR002219 | 186 | 198 | PR00008 | Protein kinase C | |
HMMPfam | IPR001849 | 38 | 130 | PF00169 | Pleckstrin-like |
IPR002219 | 148 | 200 | PF00130 | Protein kinase C | |
IPR002219 | 220 | 273 | PF00130 | Protein kinase C | |
IPR001206 | 305 | 430 | PF00781 | Diacylglycerol kinase | |
IPR000756 | 747 | 904 | PF00609 | Diacylglycerol kinase accessory region | |
IPR011510 | 1126 | 1192 | PF07647 | Sterile alpha motif homology 2 | |
HMMSmart | IPR001849 | 38 | 132 | SM00233 | Pleckstrin-like |
IPR002219 | 148 | 197 | SM00109 | Protein kinase C | |
IPR002219 | 220 | 270 | SM00109 | Protein kinase C | |
IPR001206 | 305 | 430 | SM00046 | Diacylglycerol kinase | |
IPR000756 | 747 | 904 | SM00045 | Diacylglycerol kinase accessory region | |
IPR001660 | 1126 | 1192 | SM00454 | Sterile alpha motif SAM | |
ProfileScan | IPR001849 | 37 | 130 | PS50003 | Pleckstrin-like |
IPR002219 | 147 | 197 | PS50081 | Protein kinase C | |
IPR002219 | 219 | 270 | PS50081 | Protein kinase C | |
IPR001660 | 1129 | 1192 | PS50105 | Sterile alpha motif SAM | |
ScanRegExp | IPR002219 | 148 | 197 | PS00479 | Protein kinase C |
IPR002219 | 220 | 270 | PS00479 | Protein kinase C |
Panel name | Genebridge 4 |
---|---|
Primer_f | TGAGGAAGGAATGAACATGAG |
Primer_r | AGCACTCAGGTATGGACTATG |
PCR product length | 313 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |