ROUGE |
Gene/Protein Characteristic Table for mKIAA0131 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129060 |
---|---|
mbh03533 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3823 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 377 bp Genome contig ID gi66880665r_68455015 PolyA signal sequence
(AATACA,-26) +----*----+----*----+----*----+----
GCTCTCAAAAATACAGTCTTGGTTGCTTATATCACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGATTCCTGAACATAGGTATGTCTATGGGTGTGCGAATCTTTGTATTTCA
KIAA Alignment based on: KIAA0131 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 551..1693, 1782..3446
Length: 935 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |