ROUGE |
Gene/Protein Characteristic Table for mKIAA0112 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122207 |
---|---|
Ribosome biogenesis regulatory protein homolog. | |
msj01112 [Vector Info] | |
Source : | Mouse adult spleen |
Note : | We replaced mbg06475, former representative clones for mKIAA0112 with msj01112. (2004/6/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2010 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 835 bp Genome contig ID gi65488608f_9550217 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
TTTTGTTCTTAATAAACTTATCTTTGCATAATTAGFlanking genome sequence
(102011 - 102060) ----+----*----+----*----+----*----+----*----+----*
TATTTGCATTATTTTTGTAAGTTATTAATAGCAATTCTAGAATTGAGGAA
KIAA Alignment based on: KIAA0112 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 54..1175
Length: 373 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |