ROUGE

Gene/Protein Characteristic Table for mKIAA0112

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122207
Description :	Ribosome biogenesis regulatory protein homolog.
Clone Name :	msj01112 [Vector Info]
Source :	Mouse adult spleen
Note :	We replaced mbg06475, former representative clones for mKIAA0112 with msj01112. (2004/6/22)

Features of the cloned DNA sequence	Description

Length: 2010 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 835 bp

Genome contig ID gi65488608f_9550217
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TTTTGTTCTTAATAAACTTATCTTTGCATAATTAG
Flanking genome sequence
(102011 - 102060)
----+----*----+----*----+----*----+----*----+----*
TATTTGCATTATTTTTGTAAGTTATTAATAGCAATTCTAGAATTGAGGAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0112 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0112	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 54..1175
Length: 373 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9CYH6	3.9e-128	100.0	Ribosome biogen...	Mus musculus
BAA95072	5.8e-128	99.7	unnamed protein...	Mus musculus
BAB31912	9.6e-128	99.7	unnamed protein...	Mus musculus
BAB26750	1.2e-127	99.7	unnamed protein...	Mus musculus
A1A5P2	2.5e-121	95.1	Ribosome biogen...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007023 30 205 PF04939 Ribosomal biogenesis regulatory protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007023	30	205	PF04939	Ribosomal biogenesis regulatory protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	835 bp
Genome contig ID	gi65488608f_9550217
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TTTTGTTCTTAATAAACTTATCTTTGCATAATTAG
Flanking genome sequence (102011 - 102060)	----+--------+--------+--------+--------+----* TATTTGCATTATTTTTGTAAGTTATTAATAGCAATTCTAGAATTGAGGAA

Gene/Protein Characteristic Table for mKIAA0112

Features of the cloned DNA sequence

Features of the protein sequence