Gene/Protein Characteristic Table for mKIAA0111

Length: 1413 bp

Restriction map

Length of 3'UTR	179 bp
Genome contig ID	gi65527427r_119009458
PolyA signal sequence (ATTAAA,-24)	+----*----+----*----+----*----+---- TAACCTTTTACATTAAACGTGGACATTTTCCTGTG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AGTTTGAGTGCAGATCTTTGTGGTGTCACCAGCTTTCCTGGTCTGGTCAT

KIAA	Alignment based on:
KIAA0111	DNA sequence, AA sequence, Physical map

Coding region: 2..1234

Length: 410 aa

Entry Exp ID% Protein Source Q91VC3 1.2e-168 100.0 Eukaryotic init... Mus musculus Q2NL22 4.3e-168 99.5 Eukaryotic init... Bos taurus BAC36054 5e-168 99.8 unnamed protein... Mus musculus XP_533130 5e-168 99.5 similar to DEAD... Canis lupus fam... BAE41100 5e-168 99.8 unnamed protein... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129220 1e-38 31.4 mKIAA0801 AK129402 1.4e-18 30.2 mKIAA1595 AK129241 0.0002 27.1 mKIAA0928

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	60	227	PF00270	DEAD/DEAH box helicase
	IPR001650	295	371	PF00271	Helicase
HMMSmart	IPR011545	56	253	SM00487	DEAD/DEAH box helicase
	IPR001650	290	371	SM00490	Helicase
ProfileScan	IPR001410	108	369	PS50136	DEAD/DEAH box helicase
ScanRegExp	IPR000629	184	192	PS00039	ATP-dependent helicase

Method	From	To	amino acid sequence
-	-	-	-