KIAA0111

Product ID	ORK00412
Accession No	D21853
Description	eukaryotic translation initiation factor 4A3
Clone name	ha00659
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1682 bp) Predicted protein sequence (412 aa)
HaloTag ORF Clone	FHC00412
Flexi ORF Clone	FXC00412
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0111 by Kazusa Mouse cDNA Project

Length: 1682 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	232 bp
Genome contig ID	gi51511734r_75623652
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- AGTCTTTTTCATTAAAAATTTAAAACTTTTCCCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTCTATACTTCTAAGGTGCCACCACCTTCTCTAGTAACTTACTGTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	75723652	75735533	12	100.0	Terminal No-hit

Length: 412 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P38919	1.9e-166	100.0	Eukaryotic init...	Homo sapiens
AAX29071	1.9e-166	100.0	DEAD box polype...	synthetic construct
2HYI	1.9e-166	100.0	Structure of th...	Synthetic construct
Q2NL22	4e-166	99.8	Eukaryotic init...	Bos taurus
XP_511724	5e-166	99.8	similar to DEAD...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018344	2.7e-44	33.4	KIAA0801
AB046815	1.4e-19	29.3	KIAA1595
AB023145	0.00026	24.7	KIAA0928

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	63	229	PF00270	DNA/RNA helicase
HMMPfam	IPR001650	297	373	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	58	255	SM00487	DEAD-like helicases
HMMSmart	IPR001650	292	373	SM00490	DNA/RNA helicase
ProfileScan	IPR014014	39	67	PS51195	RNA helicase
	IPR014021	70	240	PS51192	Helicase
	IPR001650	251	412	PS51194	DNA/RNA helicase
ScanRegExp	IPR000629	186	194	PS00039	RNA helicase

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	ACGACATCCGCATCCTCAGAG
Primer_r	GAACAGTCTCCCTCATCCCAC
PCR product length	119 (0.6k) bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles