ROUGE

Gene/Protein Characteristic Table for mKIAA0064

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC023732
Description :	sorting nexin 17.
Clone Name :	mpj03270 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 1938 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 428 bp

Genome contig ID gi65498774f_29552245
PolyA signal sequence
(ATTAAA,-25)
+----*----+----*----+----*----+----
GCTCCCCATCATTAAACTCAGCCTGATTGCCGCCT
Flanking genome sequence
(105595 - 105644)
----+----*----+----*----+----*----+----*----+----*
ACCTTTGGTTCCCTCTCACTGCCCCTGTCAGAAGGGGTAAGGCCTAAATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0064 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0064	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1510
Length: 502 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8BVL3	4.9e-192	100.0	Sorting nexin-17.	Mus musculus
BAC37004	1e-191	99.8	unnamed protein...	Mus musculus
XP_001089913	5e-191	95.3	sorting nexin 1...	Macaca mulatta
XP_515357	9.4e-191	95.3	sorting nexin 1...	Pan troglodytes
Q6AYS6	2.9e-190	98.7	Sorting nexin-17.	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122296	3.1e-19	26.1	mKIAA0488

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001683 33 137 PF00787 Phox-like

HMMSmart IPR001683 33 137 SM00312 Phox-like

ProfileScan IPR001683 33 141 PS50195 Phox-like

IPR000159 147 238 PS50200 RA

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001683	33	137	PF00787	Phox-like
HMMSmart	IPR001683	33	137	SM00312	Phox-like
ProfileScan	IPR001683	33	141	PS50195	Phox-like
IPR000159	147	238	PS50200	RA

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	428 bp
Genome contig ID	gi65498774f_29552245
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- GCTCCCCATCATTAAACTCAGCCTGATTGCCGCCT
Flanking genome sequence (105595 - 105644)	----+--------+--------+--------+--------+----* ACCTTTGGTTCCCTCTCACTGCCCCTGTCAGAAGGGGTAAGGCCTAAATA

Gene/Protein Characteristic Table for mKIAA0064

Features of the cloned DNA sequence

Features of the protein sequence