KIAA0064

Product ID	ORK00391
Accession No	D31764
Description	sorting nexin 17, transcript variant 1
Clone name	ha01355
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2043 bp) Predicted protein sequence (495 aa)
HaloTag ORF Clone	FHC00391
Flexi ORF Clone	FXC00391
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0064 by Kazusa Mouse cDNA Project

Length: 2043 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	408 bp
Genome contig ID	gi89161199f_27346893
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- GTTCCCCATCATTAAACTCAGCCTGACTGCTGCCT
Flanking genome sequence (106607 - 106656)	----+--------+--------+--------+--------+----* ACCTCTGGTTCCCTCTCACTGCCCCTGCTTCCCCCATCACAGCATGGACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	27446893	27453498	15	99.7	Perfect prediction

Length: 495 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_515357	6.7e-202	99.8	sorting nexin 1...	Pan troglodytes
XP_001089913	7e-200	99.4	sorting nexin 1...	Macaca mulatta
AAP36137	5.6e-191	100.0	sorting nexin 1...	synthetic construct
BAD96263	1.4e-190	99.8	sorting nexin 1...	Homo sapiens
XP_540126	1.9e-190	99.6	similar to Sort...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007957	9.1e-19	25.7	KIAA0488

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001683	26	130	PF00787	Phox-like
HMMSmart	IPR001683	26	130	SM00312	Phox-like
ProfileScan	IPR001683	26	134	PS50195	Phox-like
ProfileScan	IPR000159	140	231	PS50200	Ras-association

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TGCTTGGATGTCTGCCCTCTA
Primer_r	CAAGGAAAGGTAGGATACGAG
PCR product length	152 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles