ROUGE |
Gene/Protein Characteristic Table for mKIAA0039 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC055325 |
---|---|
DNA polymerase delta subunit 3. | |
mid11031 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2954 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1541 bp Genome contig ID gi65511124r_94088784 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TGGTGGGATTTCTAATAAAACCAAATTTGAATTGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGCTCTGGTGCGAGTTGGAGTTGTATCTTTCAAGGGAGAATGCAAACCTG
KIAA Alignment based on: KIAA0039 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..1413
Length: 470 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |