Order Kazusa clone(s) from : ![]() |
Product ID | ORK00381 |
---|---|
Accession No | D26018 |
Description | polymerase (DNA-directed), delta 3, accessory subunit, transcript variant 1 |
Clone name | ha02030 |
Vector information | |
cDNA sequence | DNA sequence (3430 bp) Predicted protein sequence (491 aa) |
HaloTag ORF Clone |
FHC00381
![]() |
Flexi ORF Clone | FXC00381 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0039
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1954 bp |
---|---|
Genome contig ID | gi51511727f_73881277 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (150138 - 150187) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 73981277 | 74031413 | 12 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | TTGGGATTGTGCTGACTTTGG |
Primer_r | GACAAATGACCAGAGGCAATG |
PCR product length | 288 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |