| ROUGE |
Gene/Protein Characteristic Table for mKIAA0039 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | BC055325 |
|---|---|
| DNA polymerase delta subunit 3. | |
| mid11031 [Vector Info] | |
| Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2954 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1541 bp Genome contig ID gi65511124r_94088784 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
TGGTGGGATTTCTAATAAAACCAAATTTGAATTGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGCTCTGGTGCGAGTTGGAGTTGTATCTTTCAAGGGAGAATGCAAACCTG
KIAA Alignment based on: KIAA0039 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..1413
Length: 470 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage
| |