ROUGE

Gene/Protein Characteristic Table for mKIAA0016

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC002087
Description :	translocase of outer mitochondrial membrane 20 homolog.
Clone Name :	mpk02476 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 997 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 463 bp

Genome contig ID gi65515060r_126122303
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATTAAAACCTTACAGAGACCGTTTCTCGTTTACTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGAAAATGTGCGGTGTGTTGTCTGTTGTTAATTCCATTCCCTCCGTGTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0016 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0016	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 46..534
Length: 162 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9DCC8	1.9e-55	100.0	Mitochondrial i...	Mus musculus
Q15388	4.9e-55	99.3	Mitochondrial i...	Homo sapiens
AAB01506	7.7e-55	98.6	rTOM20 [Rattus ...	Rattus norvegicus
BAA09714	9e-55	98.6	mitochondrial p...	Rattus sp.
CAG32999	9e-55	98.6	TOMM20 [Homo sa...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002056 14 159 PF02064 Protein import receptor MAS20

HMMTigr IPR002056 18 144 TIGR00985 Protein import receptor MAS20

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002056	14	159	PF02064	Protein import receptor MAS20
HMMTigr	IPR002056	18	144	TIGR00985	Protein import receptor MAS20

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 20 42 GRNSAIAAGVCGALFIGYCIYFD

Method	From	To	amino acid sequence
SOSUI	20	42	GRNSAIAAGVCGALFIGYCIYFD

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	463 bp
Genome contig ID	gi65515060r_126122303
PolyA signal sequence (None)	+--------+--------+----*----+---- ATTAAAACCTTACAGAGACCGTTTCTCGTTTACTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAAAATGTGCGGTGTGTTGTCTGTTGTTAATTCCATTCCCTCCGTGTG

Gene/Protein Characteristic Table for mKIAA0016

Features of the cloned DNA sequence

Features of the protein sequence