ROUGE |
Gene/Protein Characteristic Table for mKIAA0014 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172871 |
---|---|
leucine-rich repeat-containing 14. | |
msh04335 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2839 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 467 bp Genome contig ID gi65543215f_76661866 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GACTTACCTGCATTTCAAAAAAAAAAAAAAAAAACFlanking genome sequence
(121126 - 121175) ----+----*----+----*----+----*----+----*----+----*
AAAGAAGAAGAAGAAAGGGTGTCTGGTGTACTTTTCCTTATTCAAGCATC
KIAA Alignment based on: KIAA0014 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 832..1041, 1221..2372
Length: 453 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 298 | 311 | PR00019 | Leucine-rich repeat |
IPR001611 | 352 | 365 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 297 | 320 | PF00560 | Leucine-rich repeat |
ProfileScan | NULL | 246 | 374 | PS50319 | NULL |
ScanRegExp | IPR000209 | 80 | 90 | PS00136 | Peptidase S8 and S53 |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |