ROUGE |
Gene/Protein Characteristic Table for mKIAA0007 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129031 |
---|---|
Mitotic checkpoint protein BUB3. | |
mph00745 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3368 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1370 bp Genome contig ID gi65550231f_69292854 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
CTTTGTAAAGTGAATAAATACTCATCTTTACCCAGFlanking genome sequence
(142877 - 142926) ----+----*----+----*----+----*----+----*----+----*
CGCGTGTCTCGTGGTGTATATAGAGTGCACAGGTGTGTGTTTGGGCTTAG
KIAA Alignment based on: KIAA0007 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..1998
Length: 665 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |