KIAA0007

Product ID	ORK00362
Accession No	D26488
Description	WD repeat domain 43
Clone name	ha02056
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3500 bp) Predicted protein sequence (686 aa)
HaloTag ORF Clone	FHC00362
Flexi ORF Clone	FXC00362
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0007 by Kazusa Mouse cDNA Project

Length: 3500 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1437 bp
Genome contig ID	gi89161199f_28871040
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTCTTTGTAAAGTGAATAAATATTCATCTTTTCCC
Flanking genome sequence (153550 - 153599)	----+--------+--------+--------+--------+----* AGTGCTTGTCTTGTGGTATATGTAGAGGAATACAGCCACATGTTTGGGCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	28971040	29024588	18	99.5	Perfect prediction

Length: 686 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_515377	99.7	WD repeat domai...	Pan troglodytes
Q15061	100.0	WD repeat-conta...	Homo sapiens
XP_001092386	98.7	WD repeat domai...	Macaca mulatta
XP_532920	92.3	similar to WD-r...	Canis lupus fam...
XP_583609	91.5	WD repeat domai...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	28	51	PF00400	WD40 repeat
	IPR001680	125	163	PF00400	WD40 repeat
	IPR001680	167	203	PF00400	WD40 repeat
	IPR012979	499	585	PF08162	Protein of unknown function NUC189
HMMSmart	IPR001680	15	51	SM00320	WD40 repeat
	IPR001680	54	119	SM00320	WD40 repeat
	IPR001680	122	163	SM00320	WD40 repeat
	IPR001680	166	203	SM00320	WD40 repeat
	IPR001680	206	259	SM00320	WD40 repeat
ProfileScan	IPR001680	131	166	PS50082	WD40 repeat
ProfileScan	IPR001680	131	268	PS50294	WD40 repeat

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	102	QTDLLALGTAVGSILLYSTVKGE	124	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GAGCCGATATTGGCTTAGTG
Primer_r	GGTTCAAACTTGCTTTCCCA
PCR product length	240 bp
PCR conditions	95 °C15 sec58 °C60 sec30 cycles