ROUGE

Gene/Protein Characteristic Table for mKIAA0006

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AF393831
Description :	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6. Rac/Cdc42 guanine exchange factor (GEF) 6.
Clone Name :	mng13302 [Vector Info]
Source :	Mouse NKT cells

Features of the cloned DNA sequence	Description

Length: 2956 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2045 bp

Genome contig ID gi66880665r_51886202
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AGTGCTTTATAAATAAAAAAAAAAAAAAAAAAAAA
Flanking genome sequence
(2041 - 1992)
----+----*----+----*----+----*----+----*----+----*
GAATAGTATACAATGAAAGACTGACTCTTTGGAGTTCACCTAACAGCTCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0006 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0006	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..911
Length: 302 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8K4I3	5e-102	100.0	Rho guanine nuc...	Mus musculus
Q5XXR3	7.6e-99	97.0	Rho guanine nuc...	Rattus norvegicus
CAM15574	3.3e-98	97.7	Rac/Cdc42 guani...	Mus musculus
XP_001489904	8.3e-95	91.5	similar to Rho ...	Equus caballus
AAH33768	1.4e-94	90.8	Similar to Rac/...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129064	7.2e-10	52.3	mKIAA0142

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR001849 1 78 PS50003 Pleckstrin-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR001849	1	78	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2045 bp
Genome contig ID	gi66880665r_51886202
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AGTGCTTTATAAATAAAAAAAAAAAAAAAAAAAAA
Flanking genome sequence (2041 - 1992)	----+--------+--------+--------+--------+----* GAATAGTATACAATGAAAGACTGACTCTTTGGAGTTCACCTAACAGCTCT

Gene/Protein Characteristic Table for mKIAA0006

Features of the cloned DNA sequence

Features of the protein sequence