ROUGE |
Gene/Protein Characteristic Table for mKIAA0006 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AF393831 |
---|---|
Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6. Rac/Cdc42 guanine exchange factor (GEF) 6. |
|
mng13302 [Vector Info] | |
Source : | Mouse NKT cells |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2956 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2045 bp Genome contig ID gi66880665r_51886202 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
AGTGCTTTATAAATAAAAAAAAAAAAAAAAAAAAAFlanking genome sequence
(2041 - 1992) ----+----*----+----*----+----*----+----*----+----*
GAATAGTATACAATGAAAGACTGACTCTTTGGAGTTCACCTAACAGCTCT
KIAA Alignment based on: KIAA0006 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..911
Length: 302 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ProfileScan | IPR001849 | 1 | 78 | PS50003 | Pleckstrin-like |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |