Order Kazusa clone(s) from : ![]() |
Product ID | ORK04167 |
---|---|
Accession No | D25304 |
Description | Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6, transcript variant 1 |
Clone name | ha01154 |
Vector information | |
cDNA sequence | DNA sequence (4804 bp) Predicted protein sequence (773 aa) |
HaloTag ORF Clone |
FHC04167
![]() |
Flexi ORF Clone | FXC04167 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0006
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2480 bp |
---|---|
Genome contig ID | gi89161218r_135475374 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 161 | 211 | PD000066 | Src homology-3 |
FPrintScan | IPR003096 | 28 | 43 | PR00888 | SM22/calponin |
IPR003096 | 75 | 90 | PR00888 | SM22/calponin | |
IPR003096 | 96 | 110 | PR00888 | SM22/calponin | |
IPR001452 | 174 | 189 | PR00452 | Src homology-3 | |
IPR001452 | 191 | 200 | PR00452 | Src homology-3 | |
IPR001452 | 202 | 214 | PR00452 | Src homology-3 | |
HMMPfam | IPR001715 | 1 | 108 | PF00307 | Calponin-like actin-binding |
IPR001452 | 160 | 214 | PF00018 | Src homology-3 | |
IPR000219 | 242 | 417 | PF00621 | DH | |
IPR001849 | 447 | 545 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR001715 | 1 | 103 | SM00033 | Calponin-like actin-binding |
IPR001452 | 160 | 215 | SM00326 | Src homology-3 | |
IPR000219 | 242 | 417 | SM00325 | DH | |
IPR001849 | 447 | 547 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR001715 | 1 | 107 | PS50021 | Calponin-like actin-binding |
IPR001452 | 157 | 216 | PS50002 | Src homology-3 | |
IPR000219 | 238 | 418 | PS50010 | DH | |
IPR001849 | 440 | 545 | PS50003 | Pleckstrin-like |
Panel name | Genebridge 4 |
---|---|
Primer_f | AACGAAGCTTGTGCAGAGTG |
Primer_r | CCTCTACGGGCAGCAGTTTA |
PCR product length | 163 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |