ROUGE

Gene/Protein Characteristic Table for mFLJ00415

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC025621
Description :
Clone Name :	msh07154 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 3135 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 278 bp

Genome contig ID gi66880554f_24834776
PolyA signal sequence
(AATAAA,-32)
+----*----+----*----+----*----+----
ACTAATAAACGTTAATCTGATTGTGTGGCTATTTT
Flanking genome sequence
(151460 - 151509)
----+----*----+----*----+----*----+----*----+----*
ACTCTGGTGTAAAGGTTGCAGGGGCAAAGAGCTAAGTGGACCTGAGGTCG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00415 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00415	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2857
Length: 951 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH25621	100.0	Pnpla7 protein ...	Mus musculus
BAC40302	100.0	unnamed protein...	Mus musculus
A2AJ88	100.0	Patatin-like ph...	Mus musculus
BAE41783	100.0	unnamed protein...	Mus musculus
EDL08189	100.0	patatin-like ph...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000595 96 189 PF00027 Cyclic nucleotide-binding

IPR000595 213 305 PF00027 Cyclic nucleotide-binding

IPR002641 549 715 PF01734 Patatin

HMMSmart IPR000595 80 199 SM00100 Cyclic nucleotide-binding

IPR000595 202 315 SM00100 Cyclic nucleotide-binding

ProfileScan IPR000595 98 184 PS50042 Cyclic nucleotide-binding

IPR000595 212 317 PS50042 Cyclic nucleotide-binding

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000595	96	189	PF00027	Cyclic nucleotide-binding
IPR000595	213	305	PF00027	Cyclic nucleotide-binding
IPR002641	549	715	PF01734	Patatin
HMMSmart	IPR000595	80	199	SM00100	Cyclic nucleotide-binding
IPR000595	202	315	SM00100	Cyclic nucleotide-binding
ProfileScan	IPR000595	98	184	PS50042	Cyclic nucleotide-binding
IPR000595	212	317	PS50042	Cyclic nucleotide-binding

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	278 bp
Genome contig ID	gi66880554f_24834776
PolyA signal sequence (AATAAA,-32)	+--------+--------+----*----+---- ACTAATAAACGTTAATCTGATTGTGTGGCTATTTT
Flanking genome sequence (151460 - 151509)	----+--------+--------+--------+--------+----* ACTCTGGTGTAAAGGTTGCAGGGGCAAAGAGCTAAGTGGACCTGAGGTCG

Gene/Protein Characteristic Table for mFLJ00415

Features of the cloned DNA sequence

Features of the protein sequence