| ROUGE |
Gene/Protein Characteristic Table for mFLJ00392 |
| Link to : NEDO | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220248 |
|---|---|
| Protein phosphatase 1 regulatory inhibitor subunit 16A. | |
| mid31005 [Vector Info] | |
| Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2424 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 890 bp Genome contig ID gi65543215f_76622752 PolyA signal sequence
(GATAAA,-21) +----*----+----*----+----*----+----
TTATTGTGACTCTTGATAAAGGCTGTTTGCCACGGFlanking genome sequence
(123061 - 123110) ----+----*----+----*----+----*----+----*----+----*
AGCCTTCCCATGTGTCTCACTGGTTAGGAGCCACCCATGCCCAGGAGCAC
KIAA Alignment based on: FLJ00392 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 695..1387, 1534..2178
Length: 445 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |