ROUGE

Gene/Protein Characteristic Table for mFLJ00389

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK029135
Description :	TNF receptor associated factor 1.
Clone Name :	mtk00857 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 1827 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 533 bp

Genome contig ID gi66880554r_34775503
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTTAACAGACACGCAAACAGGTAAACCCAGAAACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GCCCTGGGAAATGCTTTCTGGCTGCATCTGGAGATCTTTGATGTTTTTAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00389 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00389	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 56..1294
Length: 412 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL08636	2.8e-171	100.0	Tnf receptor-as...	Mus musculus
BAC26315	8.7e-170	100.0	unnamed protein...	Mus musculus
P39428	1.4e-169	99.8	TNF receptor-as...	Mus musculus
BAE26224	2.1e-169	99.8	unnamed protein...	Mus musculus
AAH96595	4.2e-168	99.0	TNF receptor-as...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002083 269 410 PF00917 MATH

HMMSmart IPR002083 267 389 SM00061 MATH

ProfileScan IPR002083 274 412 PS50144 MATH

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002083	269	410	PF00917	MATH
HMMSmart	IPR002083	267	389	SM00061	MATH
ProfileScan	IPR002083	274	412	PS50144	MATH

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	533 bp
Genome contig ID	gi66880554r_34775503
PolyA signal sequence (None)	+--------+--------+----*----+---- GTTAACAGACACGCAAACAGGTAAACCCAGAAACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCCCTGGGAAATGCTTTCTGGCTGCATCTGGAGATCTTTGATGTTTTTAC

Gene/Protein Characteristic Table for mFLJ00389

Features of the cloned DNA sequence

Features of the protein sequence