ROUGE |
Gene/Protein Characteristic Table for mFLJ00327 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC036177 |
---|---|
mid41093 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3113 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 351 bp Genome contig ID gi65488608f_86420104 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
ATCAGTGTCATGGAATAAAATCAAGTGTGAATTGCFlanking genome sequence
(446154 - 446203) ----+----*----+----*----+----*----+----*----+----*
TGTCTGTGTAGATGCCATGGGCAAGCATGGCAGCTGGGTGGCCTGTCACC
KIAA Alignment based on: FLJ00327 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 117..2762
Length: 881 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |