ROUGE

Gene/Protein Characteristic Table for mFLJ00296

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220207
Description :
Clone Name :	mlk02300 [Vector Info]
Source :	Mouse adult splenocytes

Features of the cloned DNA sequence	Description

Length: 1607 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 412 bp

Genome contig ID gi65511124r_74593966
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GATGTCTCAGGGCCAATAAACATCAAAAAGAATAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTAAGAAGCAATTAGCAATTTACTTAGTTTTTGTACACAAGACTGGAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00296 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00296	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1195
Length: 397 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD90132	4.9e-175	100.0	mFLJ00296 prote...	Mus musculus
AAH28870	9.7e-110	91.9	Wdr73 protein [...	Mus musculus
Q9CWR1	1.1e-109	94.1	WD repeat-conta...	Mus musculus
BAE41211	1.1e-109	93.9	unnamed protein...	Mus musculus
EDM08663	3.8e-98	86.8	neuromedin B (p...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001680 292 330 PF00400 WD-40 repeat

IPR001680 342 390 PF00400 WD-40 repeat

HMMSmart IPR001680 71 116 SM00320 WD-40 repeat

IPR001680 289 330 SM00320 WD-40 repeat

IPR001680 340 390 SM00320 WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	292	330	PF00400	WD-40 repeat
IPR001680	342	390	PF00400	WD-40 repeat
HMMSmart	IPR001680	71	116	SM00320	WD-40 repeat
IPR001680	289	330	SM00320	WD-40 repeat
IPR001680	340	390	SM00320	WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	412 bp
Genome contig ID	gi65511124r_74593966
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GATGTCTCAGGGCCAATAAACATCAAAAAGAATAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTAAGAAGCAATTAGCAATTTACTTAGTTTTTGTACACAAGACTGGAC

Gene/Protein Characteristic Table for mFLJ00296

Features of the cloned DNA sequence

Features of the protein sequence