ROUGE

Gene/Protein Characteristic Table for mFLJ00283

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC068301
Description :
Clone Name :	mid24030 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 2659 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 779 bp

Genome contig ID gi65498774f_139611497
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GGTCCTGTAAAATAAAATAAAAAAAAATTTTTTTT
Flanking genome sequence
(106714 - 106763)
----+----*----+----*----+----*----+----*----+----*
AAAGTTCTGTCTTCTCTTTGAGGGTAGAACCACAGCACAGTTACAATCAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00283 DNA sequence, AA sequence

KIAA	Alignment based on:
FLJ00283	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 3..1880
Length: 625 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE41674	100.0	unnamed protein...	Mus musculus
BAC39362	100.0	unnamed protein...	Mus musculus
AAH68301	100.0	AA881470 protei...	Mus musculus
EDL19109	100.0	EST AA881470, i...	Mus musculus
BAE32593	99.8	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 298 334 PF02985 HEAT

IPR000357 347 379 PF02985 HEAT

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	298	334	PF02985	HEAT
IPR000357	347	379	PF02985	HEAT

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	779 bp
Genome contig ID	gi65498774f_139611497
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GGTCCTGTAAAATAAAATAAAAAAAAATTTTTTTT
Flanking genome sequence (106714 - 106763)	----+--------+--------+--------+--------+----* AAAGTTCTGTCTTCTCTTTGAGGGTAGAACCACAGCACAGTTACAATCAA

Gene/Protein Characteristic Table for mFLJ00283

Features of the cloned DNA sequence

Features of the protein sequence