ROUGE

Gene/Protein Characteristic Table for mFLJ00271

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC048387
Description :	immunoglobulin superfamily, member 8. PG regulatory-like protein.
Clone Name :	mib18067 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 1751 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 265 bp

Genome contig ID gi65488608f_172145363
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
CTAGTTTTTCTAAAATGTGAATAAACTGGTTTTGT
Flanking genome sequence
(103392 - 103441)
----+----*----+----*----+----*----+----*----+----*
AAAATCGAGGCCTGTTGTGTCTTCTCTTGCGGTGAAGCTATAAAAGGCAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00271 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00271	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1486
Length: 494 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH48387	1.9e-186	100.0	Immunoglobulin ...	Mus musculus
BAE34544	3.3e-186	99.8	unnamed protein...	Mus musculus
AAH26464	1.1e-185	99.6	Igsf8 protein [...	Mus musculus
Q8R366	1.1e-185	99.6	Immunoglobulin ...	Mus musculus
BAE40298	4.9e-185	99.4	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173172	3.5e-21	28.8	mKIAA1436
AK129151	1.1e-17	30.9	mKIAA0466

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam NULL 185 303 PF07686 NULL

HMMSmart IPR003599 52 168 SM00409 Immunoglobulin subtype

IPR003599 192 316 SM00409 Immunoglobulin subtype

IPR003599 328 454 SM00409 Immunoglobulin subtype

ProfileScan IPR007110 43 189 PS50835 Immunoglobulin-like

IPR007110 184 305 PS50835 Immunoglobulin-like

IPR007110 312 450 PS50835 Immunoglobulin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	NULL	185	303	PF07686	NULL
HMMSmart	IPR003599	52	168	SM00409	Immunoglobulin subtype
IPR003599	192	316	SM00409	Immunoglobulin subtype
IPR003599	328	454	SM00409	Immunoglobulin subtype
ProfileScan	IPR007110	43	189	PS50835	Immunoglobulin-like
IPR007110	184	305	PS50835	Immunoglobulin-like
IPR007110	312	450	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 462 484 FVPLLVGTGVALVTGASVLATIT

Method	From	To	amino acid sequence
SOSUI	462	484	FVPLLVGTGVALVTGASVLATIT

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	265 bp
Genome contig ID	gi65488608f_172145363
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- CTAGTTTTTCTAAAATGTGAATAAACTGGTTTTGT
Flanking genome sequence (103392 - 103441)	----+--------+--------+--------+--------+----* AAAATCGAGGCCTGTTGTGTCTTCTCTTGCGGTGAAGCTATAAAAGGCAG

Gene/Protein Characteristic Table for mFLJ00271

Features of the cloned DNA sequence

Features of the protein sequence