ROUGE |
Gene/Protein Characteristic Table for mFLJ00271 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC048387 |
---|---|
immunoglobulin superfamily, member 8. PG regulatory-like protein. |
|
mib18067 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1751 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 265 bp Genome contig ID gi65488608f_172145363 PolyA signal sequence
(AATAAA,-16) +----*----+----*----+----*----+----
CTAGTTTTTCTAAAATGTGAATAAACTGGTTTTGTFlanking genome sequence
(103392 - 103441) ----+----*----+----*----+----*----+----*----+----*
AAAATCGAGGCCTGTTGTGTCTTCTCTTGCGGTGAAGCTATAAAAGGCAG
KIAA Alignment based on: FLJ00271 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1486
Length: 494 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |