ROUGE

Gene/Protein Characteristic Table for mFLJ00248

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131167
Description :	Leucine-rich repeats and calponin homology domain containing protein 4.
Clone Name :	mfj21306 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4672 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2385 bp

Genome contig ID gi65498774f_136479796
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
CCAAGCTGTTTTGTTGACAATAAATCAGAGTTTGC
Flanking genome sequence
(113703 - 113752)
----+----*----+----*----+----*----+----*----+----*
AAACCAGGCTGTCTGCAGTGGGACATGGGCTGCGGATCAGGCTGGGTCCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00248 DNA sequence, AA sequence

KIAA	Alignment based on:
FLJ00248	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 1..978, 1211..1705
Length: 491 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21417	1.3e-179	100.0	mFLJ00248 prote...	Mus musculus
BAC40287	2.9e-176	99.0	unnamed protein...	Mus musculus
Q921G6	3e-176	99.0	Leucine-rich re...	Mus musculus
EDM13248	1.5e-165	92.8	rCG21252 [Rattu...	Rattus norvegicus
AAI66781	4.6e-164	91.9	Lrch4 protein [...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129264	1.4e-36	54.5	mKIAA1016
BC049775	2.5e-10	33.9	mKIAA0862
AK220166	2e-09	34.1	mKIAA4018
AK122211	4.1e-08	27.5	mKIAA0147
BC048152	8.1e-08	29.5	mKIAA1437

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 120 133 PR00019 Leucine-rich repeat

IPR001611 162 175 PR00019 Leucine-rich repeat

HMMPfam IPR001611 96 118 PF00560 Leucine-rich repeat

IPR001611 119 138 PF00560 Leucine-rich repeat

IPR001611 141 163 PF00560 Leucine-rich repeat

IPR001611 164 186 PF00560 Leucine-rich repeat

IPR001611 187 206 PF00560 Leucine-rich repeat

IPR001611 209 231 PF00560 Leucine-rich repeat

HMMSmart NULL 71 93 SM00366 NULL

NULL 94 116 SM00366 NULL

IPR003591 94 116 SM00369 Leucine-rich repeat

NULL 117 139 SM00366 NULL

IPR003591 117 140 SM00369 Leucine-rich repeat

NULL 140 161 SM00366 NULL

NULL 162 184 SM00366 NULL

IPR003591 162 184 SM00369 Leucine-rich repeat

NULL 185 207 SM00366 NULL

IPR003591 185 208 SM00369 Leucine-rich repeat

NULL 208 229 SM00366 NULL

NULL 230 252 SM00366 NULL

IPR003591 230 253 SM00369 Leucine-rich repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	120	133	PR00019	Leucine-rich repeat
IPR001611	162	175	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	96	118	PF00560	Leucine-rich repeat
IPR001611	119	138	PF00560	Leucine-rich repeat
IPR001611	141	163	PF00560	Leucine-rich repeat
IPR001611	164	186	PF00560	Leucine-rich repeat
IPR001611	187	206	PF00560	Leucine-rich repeat
IPR001611	209	231	PF00560	Leucine-rich repeat
HMMSmart	NULL	71	93	SM00366	NULL
NULL	94	116	SM00366	NULL
IPR003591	94	116	SM00369	Leucine-rich repeat
NULL	117	139	SM00366	NULL
IPR003591	117	140	SM00369	Leucine-rich repeat
NULL	140	161	SM00366	NULL
NULL	162	184	SM00366	NULL
IPR003591	162	184	SM00369	Leucine-rich repeat
NULL	185	207	SM00366	NULL
IPR003591	185	208	SM00369	Leucine-rich repeat
NULL	208	229	SM00366	NULL
NULL	230	252	SM00366	NULL
IPR003591	230	253	SM00369	Leucine-rich repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2385 bp
Genome contig ID	gi65498774f_136479796
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CCAAGCTGTTTTGTTGACAATAAATCAGAGTTTGC
Flanking genome sequence (113703 - 113752)	----+--------+--------+--------+--------+----* AAACCAGGCTGTCTGCAGTGGGACATGGGCTGCGGATCAGGCTGGGTCCC

Gene/Protein Characteristic Table for mFLJ00248

Features of the cloned DNA sequence

Features of the protein sequence