ROUGE

Gene/Protein Characteristic Table for mFLJ00191

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131150
Description :	zinc finger, ZZ domain containing 3.
Clone Name :	mpm11002 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4195 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1078 bp

Genome contig ID gi65492966f_151277755
PolyA signal sequence
(AATAAA,-33)
+----*----+----*----+----*----+----
GAAATAAACGATGTGGATATGTTTGTTTATATCAT
Flanking genome sequence
(163496 - 163545)
----+----*----+----*----+----*----+----*----+----*
AGAAAGCTTGTTGTGGATTCCTTTGGGTCAAATTTTGATTTTTTTTCAAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00191 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00191	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 367..3117
Length: 916 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD21400	100.0	mFLJ00191 prote...	Mus musculus
EDL11921	99.9	zinc finger, ZZ...	Mus musculus
Q6KAQ7	100.0	ZZ-type zinc fi...	Mus musculus
XP_547324	88.2	similar to zinc...	Canis lupus fam...
XP_513508	87.4	zinc finger, ZZ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001005 665 716 PF00249 Myb

IPR000433 830 878 PF00569 Zinc finger

HMMSmart NULL 664 718 SM00395 NULL

ProfileScan IPR001005 660 716 PS50090 Myb

IPR000433 830 880 PS50135 Zinc finger

ScanRegExp IPR000433 836 866 PS01357 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001005	665	716	PF00249	Myb
IPR000433	830	878	PF00569	Zinc finger
HMMSmart	NULL	664	718	SM00395	NULL
ProfileScan	IPR001005	660	716	PS50090	Myb
IPR000433	830	880	PS50135	Zinc finger
ScanRegExp	IPR000433	836	866	PS01357	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1078 bp
Genome contig ID	gi65492966f_151277755
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- GAAATAAACGATGTGGATATGTTTGTTTATATCAT
Flanking genome sequence (163496 - 163545)	----+--------+--------+--------+--------+----* AGAAAGCTTGTTGTGGATTCCTTTGGGTCAAATTTTGATTTTTTTTCAAC

Gene/Protein Characteristic Table for mFLJ00191

Features of the cloned DNA sequence

Features of the protein sequence