ROUGE

Gene/Protein Characteristic Table for mFLJ00183

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK048244
Description :	cyclin L2 isoform 1. Paneth cell enhanced expression.
Clone Name :	mpm03276 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4011 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 658 bp

Genome contig ID gi65493515f_154204944
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
GGTTGAATAAACAATTCTCAGGACACTTGTTATGT
Flanking genome sequence
(111776 - 111825)
----+----*----+----*----+----*----+----*----+----*
AAGACTTTGTGGGCTGTCATTCTGGTTGTTTCTTTGAGTGTATGCCTGGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00183 DNA sequence, AA sequence

KIAA	Alignment based on:
FLJ00183	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 1..678, 2781..3353
Length: 416 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAF23011	3.8e-69	100.0	cyclin ania-6b ...	Mus musculus
BAE41413	6.2e-69	99.6	unnamed protein...	Mus musculus
AAH88316	3.4e-68	98.2	Cyclin L2 [Ratt...	Rattus norvegicus
BAC26255	3.8e-67	99.5	unnamed protein...	Mus musculus
Q9JJA7	4.8e-67	79.3	Cyclin-L2; Cycl...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006671 39 192 PF00134 Cyclin

HMMSmart IPR006670 83 185 SM00385 Cyclin

ProfileScan NULL 4 29 PS50310 NULL

NULL 275 369 PS50324 NULL

NULL 276 416 PS50323 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006671	39	192	PF00134	Cyclin
HMMSmart	IPR006670	83	185	SM00385	Cyclin
ProfileScan	NULL	4	29	PS50310	NULL
NULL	275	369	PS50324	NULL
NULL	276	416	PS50323	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	658 bp
Genome contig ID	gi65493515f_154204944
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- GGTTGAATAAACAATTCTCAGGACACTTGTTATGT
Flanking genome sequence (111776 - 111825)	----+--------+--------+--------+--------+----* AAGACTTTGTGGGCTGTCATTCTGGTTGTTTCTTTGAGTGTATGCCTGGG

Gene/Protein Characteristic Table for mFLJ00183

Features of the cloned DNA sequence

Features of the protein sequence