ROUGE

Gene/Protein Characteristic Table for mFLJ00175

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131144
Description :
Clone Name :	mtg01832 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 6660 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 228 bp

Genome contig ID gi65504368f_84267193
PolyA signal sequence
(AATATA,-21)
+----*----+----*----+----*----+----
AGACAGAACCAGAAAATATATTGCTATGTGTCTAC
Flanking genome sequence
(296087 - 296136)
----+----*----+----*----+----*----+----*----+----*
AGTTCCTGAATGAGCGAGACTGTGTGGGAGGGAGGGGCTGGGGGAGATCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00175 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00175	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 76..6432
Length: 2118 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD21394	100.0	mFLJ00175 prote...	Mus musculus
NP_067444	100.0	dysferlin isofo...	Mus musculus
NP_001071162	99.0	dysferlin isofo...	Mus musculus
ACB12761	94.0	dysferlin varia...	Homo sapiens
ACB12755	93.1	dysferlin varia...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173131	0	55.6	mKIAA1207

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000008 1633 1645 PR00360 C2

IPR000008 1659 1672 PR00360 C2

IPR000008 1681 1689 PR00360 C2

HMMPfam IPR000008 20 104 PF00168 C2

IPR000008 274 354 PF00168 C2

IPR012968 355 426 PF08151 FerI

IPR000008 433 531 PF00168 C2

IPR012560 732 797 PF08165 FerA

IPR012561 824 899 PF08150 FerB

IPR000008 1192 1282 PF00168 C2

IPR000008 1372 1459 PF00168 C2

IPR000008 1618 1701 PF00168 C2

HMMSmart IPR000008 19 119 SM00239 C2

IPR000008 273 369 SM00239 C2

IPR000008 432 546 SM00239 C2

IPR000008 1191 1299 SM00239 C2

IPR000008 1368 1475 SM00239 C2

IPR000008 1617 1716 SM00239 C2

IPR000008 1850 1979 SM00239 C2

ProfileScan IPR000008 24 104 PS50004 C2

IPR000008 259 354 PS50004 C2

IPR000008 435 536 PS50004 C2

NULL 1076 1135 PS50323 NULL

IPR000008 1177 1282 PS50004 C2

IPR000008 1603 1701 PS50004 C2

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	1633	1645	PR00360	C2
IPR000008	1659	1672	PR00360	C2
IPR000008	1681	1689	PR00360	C2
HMMPfam	IPR000008	20	104	PF00168	C2
IPR000008	274	354	PF00168	C2
IPR012968	355	426	PF08151	FerI
IPR000008	433	531	PF00168	C2
IPR012560	732	797	PF08165	FerA
IPR012561	824	899	PF08150	FerB
IPR000008	1192	1282	PF00168	C2
IPR000008	1372	1459	PF00168	C2
IPR000008	1618	1701	PF00168	C2
HMMSmart	IPR000008	19	119	SM00239	C2
IPR000008	273	369	SM00239	C2
IPR000008	432	546	SM00239	C2
IPR000008	1191	1299	SM00239	C2
IPR000008	1368	1475	SM00239	C2
IPR000008	1617	1716	SM00239	C2
IPR000008	1850	1979	SM00239	C2
ProfileScan	IPR000008	24	104	PS50004	C2
IPR000008	259	354	PS50004	C2
IPR000008	435	536	PS50004	C2
NULL	1076	1135	PS50323	NULL
IPR000008	1177	1282	PS50004	C2
IPR000008	1603	1701	PS50004	C2

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 13 33 RLGCGAMLCCLLARASNLPNV

2082 2104 RCAIILFIILFILLLFLGVFVYA

Method	From	To	amino acid sequence
SOSUI	13	33	RLGCGAMLCCLLARASNLPNV
2082	2104	RCAIILFIILFILLLFLGVFVYA

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	228 bp
Genome contig ID	gi65504368f_84267193
PolyA signal sequence (AATATA,-21)	+--------+--------+----*----+---- AGACAGAACCAGAAAATATATTGCTATGTGTCTAC
Flanking genome sequence (296087 - 296136)	----+--------+--------+--------+--------+----* AGTTCCTGAATGAGCGAGACTGTGTGGGAGGGAGGGGCTGGGGGAGATCA

Gene/Protein Characteristic Table for mFLJ00175

Features of the cloned DNA sequence

Features of the protein sequence