ROUGE

Gene/Protein Characteristic Table for mFLJ00168

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AY161348
Description :	Interleukin-4 induced protein 1 precursor.
Clone Name :	msj09064 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 2015 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 100 bp

Genome contig ID gi65511124f_38811559
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ACTAATAGCCCACAATAAAGTTATTTTTGTTAAAC
Flanking genome sequence
(104177 - 104226)
----+----*----+----*----+----*----+----*----+----*
CACAGGCTCACTTCCCTCCACAATGCACTGGTTTCCAGAATATAACTGCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00168 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00168	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 20..1915
Length: 631 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAO23118	100.0	interleukin-fou...	Mus musculus
EDL22757	99.8	interleukin 4 i...	Mus musculus
O09046	99.8	L-amino-acid ox...	Mus musculus
BAE30174	99.8	unnamed protein...	Mus musculus
AAO65453	99.7	interleukin-fou...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129170	1e-06	24.5	mKIAA0601

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006076 61 502 PF01266 FAD dependent oxidoreductase

IPR002937 69 504 PF01593 Amine oxidase

ProfileScan IPR000205 62 92 PS50205 NAD-binding site

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 1 23 AMAGLALRLVLAATLLGLAGSLD

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006076	61	502	PF01266	FAD dependent oxidoreductase
IPR002937	69	504	PF01593	Amine oxidase
ProfileScan	IPR000205	62	92	PS50205	NAD-binding site

Method	From	To	amino acid sequence
SOSUI	1	23	AMAGLALRLVLAATLLGLAGSLD

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	100 bp
Genome contig ID	gi65511124f_38811559
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACTAATAGCCCACAATAAAGTTATTTTTGTTAAAC
Flanking genome sequence (104177 - 104226)	----+--------+--------+--------+--------+----* CACAGGCTCACTTCCCTCCACAATGCACTGGTTTCCAGAATATAACTGCC

Gene/Protein Characteristic Table for mFLJ00168

Features of the cloned DNA sequence

Features of the protein sequence