ROUGE

Gene/Protein Characteristic Table for mKIAA0601

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129170
Description :
Clone Name :	mbh00670 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 2942 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 302 bp

Genome contig ID gi65493515r_135331806
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
ATTTTGAGAATAAAACTTTAAAATAATTTTATATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATTTATTTTTAATTGTGTGTGTGTGTGTCTATGTTGGAATGCACATT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0601 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0601	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2640
Length: 879 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6ZQ88	100.0	Lysine-specific...	Mus musculus
XP_612243	98.7	amine oxidase (...	Bos taurus
XP_866610	98.7	similar to Lysi...	Canis lupus fam...
O60341	98.1	Lysine-specific...	Homo sapiens
AAH48134	98.0	Amine oxidase (...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000104 35 49 PR00308 Antifreeze protein

IPR000104 49 60 PR00308 Antifreeze protein

IPR000104 60 69 PR00308 Antifreeze protein

HMMPfam IPR007526 201 291 PF04433 SWIRM

IPR006076 307 758 PF01266 FAD dependent oxidoreductase

IPR002937 315 853 PF01593 Amine oxidase

ProfileScan NULL 20 82 PS50310 NULL

IPR000205 308 336 PS50205 NAD-binding site

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000104	35	49	PR00308	Antifreeze protein
IPR000104	49	60	PR00308	Antifreeze protein
IPR000104	60	69	PR00308	Antifreeze protein
HMMPfam	IPR007526	201	291	PF04433	SWIRM
IPR006076	307	758	PF01266	FAD dependent oxidoreductase
IPR002937	315	853	PF01593	Amine oxidase
ProfileScan	NULL	20	82	PS50310	NULL
IPR000205	308	336	PS50205	NAD-binding site

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	302 bp
Genome contig ID	gi65493515r_135331806
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- ATTTTGAGAATAAAACTTTAAAATAATTTTATATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATTTATTTTTAATTGTGTGTGTGTGTGTCTATGTTGGAATGCACATT

Gene/Protein Characteristic Table for mKIAA0601

Features of the cloned DNA sequence

Features of the protein sequence