ROUGE |
Gene/Protein Characteristic Table for mFLJ00147 |
Link to : NEDO | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131138 |
---|---|
ubiquitin specific protease 47. | |
mbh00776 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4215 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1265 bp Genome contig ID gi65511124f_105827851 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
ACAATGAACATGCCAATAAAACATTTGTTCATGTTFlanking genome sequence
(136673 - 136722) ----+----*----+----*----+----*----+----*----+----*
GCTGTGTTATCTTAGTCATTAACCTCGGGGCACAATAATGGATCTGGGTA
KIAA Alignment based on: FLJ00147 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..2950
Length: 982 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |