ROUGE

Gene/Protein Characteristic Table for mFLJ00110

Link to : NEDO \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131132
Description :	Max-interacting transcriptional repressor MAD4.
Clone Name :	mpj01066 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 1687 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 950 bp

Genome contig ID gi65498774r_32564303
PolyA signal sequence
(AAGAAA,-8)
+----*----+----*----+----*----+----
CTCCAAGCTTTCTCAACTTCCTTTCTTAAGAAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGAAAAAAAAAAAGTGCGACAGGGAGCTCCCAGAAGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00110 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00110	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..737
Length: 244 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD21382	2.7e-91	100.0	mFLJ00110 prote...	Mus musculus
EDM00104	2.1e-89	98.8	Max dimerizatio...	Rattus norvegicus
EDM00103	1e-77	96.0	Max dimerizatio...	Rattus norvegicus
AAH11303	1e-76	100.0	Max dimerizatio...	Mus musculus
BAB25287	3.3e-76	99.0	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001092 89 141 PF00010 Basic helix-loop-helix dimerisation region bHLH

HMMSmart IPR001092 94 146 SM00353 Basic helix-loop-helix dimerisation region bHLH

ProfileScan IPR001092 73 141 PS50888 Basic helix-loop-helix dimerisation region bHLH

NULL 98 138 PS50037 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001092	89	141	PF00010	Basic helix-loop-helix dimerisation region bHLH
HMMSmart	IPR001092	94	146	SM00353	Basic helix-loop-helix dimerisation region bHLH
ProfileScan	IPR001092	73	141	PS50888	Basic helix-loop-helix dimerisation region bHLH
NULL	98	138	PS50037	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	950 bp
Genome contig ID	gi65498774r_32564303
PolyA signal sequence (AAGAAA,-8)	+--------+--------+----*----+---- CTCCAAGCTTTCTCAACTTCCTTTCTTAAGAAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGAAAAAAAAAAAGTGCGACAGGGAGCTCCCAGAAGG

Gene/Protein Characteristic Table for mFLJ00110

Features of the cloned DNA sequence

Features of the protein sequence