ROUGE |
Gene/Protein Characteristic Table for mFLJ00107 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131130 |
---|---|
zinc finger protein 521. ecotropic viral integration site 3. |
|
mfj24090 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5034 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 779 bp Genome contig ID gi65551972r_13776627 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TGTTTTCCAAGAGGAAATAAATTCAGTTTACCATCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGCTGTGAGTGTATTTGTGTGTTTTCCTTTTCTAGTTAGTCTTACCATTA
KIAA Alignment based on: FLJ00107 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 140..4255
Length: 1371 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |