ROUGE |
Gene/Protein Characteristic Table for mFLJ00098 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131129 |
---|---|
Solute carrier family 12 member 7. | |
mpg00643 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5082 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1806 bp Genome contig ID gi65535943f_69723603 PolyA signal sequence
(AGTAAA,-20) +----*----+----*----+----*----+----
CTTTGTTAGTAGCAGAGTAAAGTTCTATAAAATATFlanking genome sequence
(153116 - 153165) ----+----*----+----*----+----*----+----*----+----*
AAATGTTTAAGGAACTTCGTGTGCCTCATTTCCATAGAATTCAGTGGTGG
KIAA Alignment based on: FLJ00098 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..3276
Length: 1091 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |