ROUGE |
Gene/Protein Characteristic Table for mFLJ00088 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220303 |
---|---|
Neutral alpha-glucosidase C. | |
mfj58158 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4823 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 926 bp Genome contig ID gi66880554f_119818074 PolyA signal sequence
(AATACA,-33) +----*----+----*----+----*----+----
CCAATACACTGTCTTTAAAAATCAAAATGAATGCCFlanking genome sequence
(156628 - 156677) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAACCCTTACAGGCTTAACAAAAGGTTCTAAATAAAG
KIAA Alignment based on: FLJ00088 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 1183..3897
Length: 904 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |