ROUGE

Gene/Protein Characteristic Table for mFLJ00088

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220303
Description :	Neutral alpha-glucosidase C.
Clone Name :	mfj58158 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4823 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 926 bp

Genome contig ID gi66880554f_119818074
PolyA signal sequence
(AATACA,-33)
+----*----+----*----+----*----+----
CCAATACACTGTCTTTAAAAATCAAAATGAATGCC
Flanking genome sequence
(156628 - 156677)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAACCCTTACAGGCTTAACAAAAGGTTCTAAATAAAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00088 DNA sequence, AA sequence

KIAA	Alignment based on:
FLJ00088	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 1183..3897
Length: 904 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD90228	100.0	mFLJ00088 prote...	Mus musculus
CAM24145	98.8	glucosidase alp...	Mus musculus
EDL27994	97.3	mCG132433, isof...	Mus musculus
Q8BVW0	97.0	Neutral alpha-g...	Mus musculus
AAI12052	84.2	Glucosidase, al...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122201	1.3e-190	55.8	mKIAA0088
AK173117	1.1e-10	24.1	mKIAA1161

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000322 324 769 PF01055 Glycoside hydrolase

ScanRegExp IPR000322 497 504 PS00129 Glycoside hydrolase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000322	324	769	PF01055	Glycoside hydrolase
ScanRegExp	IPR000322	497	504	PS00129	Glycoside hydrolase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	926 bp
Genome contig ID	gi66880554f_119818074
PolyA signal sequence (AATACA,-33)	+--------+--------+----*----+---- CCAATACACTGTCTTTAAAAATCAAAATGAATGCC
Flanking genome sequence (156628 - 156677)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAACCCTTACAGGCTTAACAAAAGGTTCTAAATAAAG

Gene/Protein Characteristic Table for mFLJ00088

Features of the cloned DNA sequence

Features of the protein sequence