ROUGE

Gene/Protein Characteristic Table for mKIAA1161

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173117
Description :
Clone Name :	mbh03358 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4155 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1875 bp

Genome contig ID gi65493515r_41534621
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AAAGCAGGTGCTCAATAAAAGAGAGCTATTGAAGT
Flanking genome sequence
(99836 - 99787)
----+----*----+----*----+----*----+----*----+----*
AGTATTTGTTGTTTTCTTGCTTAAAAACAAGGATTCTTGGGGGTTTAAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1161 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1161	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 124..2280
Length: 718 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI40957	99.9	AI464131 protei...	Mus musculus
EDL98671	96.2	rCG55123, isofo...	Rattus norvegicus
XP_531978	92.9	similar to CG11...	Canis lupus fam...
XP_001498447	92.2	similar to CG11...	Equus caballus
XP_607425	91.6	similar to CG11...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220303	3.1e-10	24.4	mFLJ00088
AK122201	5.1e-10	24.0	mKIAA0088

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000322 301 716 PF01055 Glycoside hydrolase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000322	301	716	PF01055	Glycoside hydrolase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 58 80 LLCSAVLGLLLVLAAVVAWCYYS

Method	From	To	amino acid sequence
SOSUI	58	80	LLCSAVLGLLLVLAAVVAWCYYS

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1875 bp
Genome contig ID	gi65493515r_41534621
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAAGCAGGTGCTCAATAAAAGAGAGCTATTGAAGT
Flanking genome sequence (99836 - 99787)	----+--------+--------+--------+--------+----* AGTATTTGTTGTTTTCTTGCTTAAAAACAAGGATTCTTGGGGGTTTAAAA

Gene/Protein Characteristic Table for mKIAA1161

Features of the cloned DNA sequence

Features of the protein sequence