| ROUGE |
Gene/Protein Characteristic Table for mFLJ00045 |
| Link to : NEDO | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK131120 |
|---|---|
| APG16L beta isoform. autophagy 16-like. |
|
| mfj40199 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4162 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 3219 bp Genome contig ID gi65488608f_87472684 PolyA signal sequence
(AAGAAA,-30) +----*----+----*----+----*----+----
TAAAGAAGAAATTCTGTTATATACTTTTCAAACTCFlanking genome sequence
(136318 - 136367) ----+----*----+----*----+----*----+----*----+----*
CTTGCGTCTTGATTGTCTTTTCTGTCACATCCTTAAGTAAGGGGGAAAGG
KIAA Alignment based on: FLJ00045 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 68..883, 1828..2325, 2519..3043
Length: 612 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |