ROUGE

Gene/Protein Characteristic Table for mFLJ00042

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC029777
Description :	ras homolog gene family, member T2. mitochondrial Rho 2.
Clone Name :	mej02415 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 2026 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 529 bp

Genome contig ID gi65550231r_23545001
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
CTGACTTTCCTGATTAAATTTCACTTGTCTTTTCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCTCTTGGATTTTGATCTCTCAATGCAACTTACTTTCTCTCTTTCTCTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00042 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00042	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1497
Length: 498 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8JZN7	0	100.0	Mitochondrial R...	Mus musculus
Q7TSA0	1.6e-203	93.2	Mitochondrial R...	Rattus norvegicus
EDM03970	2.6e-202	92.5	ras homolog gen...	Rattus norvegicus
AAK61240	1e-180	82.9	similar to AK00...	Homo sapiens
Q8IXI1	3e-180	82.9	Mitochondrial R...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002048 186 214 PF00036 Calcium-binding EF-hand

HMMSmart IPR002048 66 94 SM00054 Calcium-binding EF-hand

IPR002048 186 214 SM00054 Calcium-binding EF-hand

ScanRegExp IPR002048 195 207 PS00018 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002048	186	214	PF00036	Calcium-binding EF-hand
HMMSmart	IPR002048	66	94	SM00054	Calcium-binding EF-hand
IPR002048	186	214	SM00054	Calcium-binding EF-hand
ScanRegExp	IPR002048	195	207	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 472 494 RGVLVAVGTAVAAVLSFSLYRVL

Method	From	To	amino acid sequence
SOSUI	472	494	RGVLVAVGTAVAAVLSFSLYRVL

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	529 bp
Genome contig ID	gi65550231r_23545001
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- CTGACTTTCCTGATTAAATTTCACTTGTCTTTTCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTCTTGGATTTTGATCTCTCAATGCAACTTACTTTCTCTCTTTCTCTC

Gene/Protein Characteristic Table for mFLJ00042

Features of the cloned DNA sequence

Features of the protein sequence