HUGE

Gene/Protein Characteristic Table for KIAA2021

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00310
Accession No. :	AB095941
Description :	Uncharacterized protein C14orf21.
HUGO Gene Name :
Clone Name :	ah05004 [Vector Info]
Flexi ORF Clone :	pF1KA2021
Source :	Human brain (amygdala)

Features of the cloned DNA sequence	Description

Length: 6033 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4029 bp

Genome contig ID gi51511730f_23738908
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TAAGTACATTCTCCTAATAAATGCTTTGGACTGAT
Flanking genome sequence
(109264 - 109313)
----+----*----+----*----+----*----+----*----+----*
CACCCTGCCAGTCTTTTGTCTTGGGCAATCTATACTTTTCTCAGAGGTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 23838908 23848170 10 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 648 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86U38	0	100.0	Pumilio domain-...	Homo sapiens
EAW66035	0	99.7	chromosome 14 o...	Homo sapiens
CAI46005	0	99.5	hypothetical pr...	Homo sapiens
XP_001113913	0	96.4	similar to Prot...	Macaca mulatta
AAI40559	2.2e-210	88.7	LOC528833 prote...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001313 104 135 PF00806 Pumilio/Puf RNA-binding

IPR001313 201 235 PF00806 Pumilio/Puf RNA-binding

IPR001313 325 360 PF00806 Pumilio/Puf RNA-binding

IPR001313 363 398 PF00806 Pumilio/Puf RNA-binding

IPR001313 521 556 PF00806 Pumilio/Puf RNA-binding

IPR001313 559 593 PF00806 Pumilio/Puf RNA-binding

HMMSmart IPR001313 201 232 SM00025 Pumilio/Puf RNA-binding

IPR001313 275 310 SM00025 Pumilio/Puf RNA-binding

IPR001313 326 361 SM00025 Pumilio/Puf RNA-binding

IPR001313 363 399 SM00025 Pumilio/Puf RNA-binding

IPR001313 521 558 SM00025 Pumilio/Puf RNA-binding

IPR001313 559 594 SM00025 Pumilio/Puf RNA-binding

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001313	104	135	PF00806	Pumilio/Puf RNA-binding
IPR001313	201	235	PF00806	Pumilio/Puf RNA-binding
IPR001313	325	360	PF00806	Pumilio/Puf RNA-binding
IPR001313	363	398	PF00806	Pumilio/Puf RNA-binding
IPR001313	521	556	PF00806	Pumilio/Puf RNA-binding
IPR001313	559	593	PF00806	Pumilio/Puf RNA-binding
HMMSmart	IPR001313	201	232	SM00025	Pumilio/Puf RNA-binding
IPR001313	275	310	SM00025	Pumilio/Puf RNA-binding
IPR001313	326	361	SM00025	Pumilio/Puf RNA-binding
IPR001313	363	399	SM00025	Pumilio/Puf RNA-binding
IPR001313	521	558	SM00025	Pumilio/Puf RNA-binding
IPR001313	559	594	SM00025	Pumilio/Puf RNA-binding

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTAGGGGATTAGATGTAGCAG

Primer_r
: CCTTTCAGCATAACGCCTCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4029 bp
Genome contig ID	gi51511730f_23738908
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TAAGTACATTCTCCTAATAAATGCTTTGGACTGAT
Flanking genome sequence (109264 - 109313)	----+--------+--------+--------+--------+----* CACCCTGCCAGTCTTTTGTCTTGGGCAATCTATACTTTTCTCAGAGGTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	23838908	23848170	10	99.3	Perfect prediction

Primer_f	: GTAGGGGATTAGATGTAGCAG
Primer_r	: CCTTTCAGCATAACGCCTCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2021

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information