ROUGE |
Gene/Protein Characteristic Table for mKIAA2021 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK032873 |
---|---|
mnh06352 [Vector Info] | |
Source : | Mouse NKT cells |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2207 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 263 bp Genome contig ID gi65540054f_50163758 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AGACATACTGGTAAAGACTTTTGTATTTTTCTTGGFlanking genome sequence
(108322 - 108371) ----+----*----+----*----+----*----+----*----+----*
AAATATTTTTATTTTATTTTTTAGGGGAAAGTTATCTTGTAGTAAAGCTA
KIAA Alignment based on: KIAA2021 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 13..1944
Length: 643 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |