HUGE

Gene/Protein Characteristic Table for KIAA2005

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00969
Accession No. :	AB095926
Description :	Sterile alpha motif domain-containing protein 9-like.
HUGO Gene Name :	sterile alpha motif domain containing 9-like (SAMD9L)
Clone Name :	eg01633 [Vector Info]
Flexi ORF Clone :	pF1KSDA2005
Source :

Features of the cloned DNA sequence	Description

Length: 7122 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1162 bp

Genome contig ID gi89161213r_92497304
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
TGAATATTGAATAAAAAATATATTTATTTATCCAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCTTTGTATCTCTTTGTAATGTAACTTAGATATTCTGGACTCCAAACCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 92597304 92615605 5 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1587 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IVG5	100.0	Sterile alpha m...	Homo sapiens
XP_527818	99.4	sterile alpha m...	Pan troglodytes
AAI27119	99.8	SAMD9L protein ...	Homo sapiens
XP_001099842	95.3	similar to ster...	Macaca mulatta
AAI27118	99.8	SAMD9L protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095925	0	60.3	KIAA2004

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR001660 17 63 PS50105 Sterile alpha motif SAM

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR001660	17	63	PS50105	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAGAGATAAAGTGTACCTGTC

Primer_r
: ATAGACTGGACTGCTGCTGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1162 bp
Genome contig ID	gi89161213r_92497304
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TGAATATTGAATAAAAAATATATTTATTTATCCAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTTTGTATCTCTTTGTAATGTAACTTAGATATTCTGGACTCCAAACCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	92597304	92615605	5	99.9	Perfect prediction

Primer_f	: GAGAGATAAAGTGTACCTGTC
Primer_r	: ATAGACTGGACTGCTGCTGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2005

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information