HUGE

Gene/Protein Characteristic Table for KIAA2001

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01188
Accession No. :	AB082532
Description :
HUGO Gene Name :	retrotransposon gag domain containing 4 (RGAG4)
Clone Name :	bj00176 [Vector Info]
Flexi ORF Clone :	pF1KA2001
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4356 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2285 bp

Genome contig ID gi89161218r_71163688
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GCTTTCTCTCCTCAATAAAAATATAAAGGGTGTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGATTGTGCCTCTTTGTTATTGAGCAAGCATAGATGGGTACAGAGTAG

Features of the protein sequence	Description

Length: 689 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_549073	2.6e-115	78.4	similar to retr...	Canis lupus fam...
BAB46855	1e-95	96.3	hypothetical pr...	Macaca fascicularis
CAB94872	6.8e-92	100.0	hypothetical pr...	Homo sapiens
Q5DTT4	3.4e-76	66.3	Retrotransposon...	Mus musculus
EDL95878	3.4e-60	66.4	rCG36266 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005162 309 402 PF03732 Retrotransposon gag protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005162	309	402	PF03732	Retrotransposon gag protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GACTTCTAGGTACAAACTCAG

Primer_r
: TGCAGAAAGTCCAGTGTCCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2285 bp
Genome contig ID	gi89161218r_71163688
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GCTTTCTCTCCTCAATAAAAATATAAAGGGTGTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGATTGTGCCTCTTTGTTATTGAGCAAGCATAGATGGGTACAGAGTAG

Primer_f	: GACTTCTAGGTACAAACTCAG
Primer_r	: TGCAGAAAGTCCAGTGTCCAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2001

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information