| HUGE |
Gene/Protein Characteristic Table for KIAA2001 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01188 |
|---|---|
| Accession No. : | AB082532 |
| Description : | |
| HUGO Gene Name : | retrotransposon gag domain containing 4 (RGAG4) |
| Clone Name : | bj00176 [Vector Info] |
| Flexi ORF Clone : | pF1KA2001
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4356 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2285 bp Genome contig ID gi89161218r_71163688 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
GCTTTCTCTCCTCAATAAAAATATAAAGGGTGTGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAGATTGTGCCTCTTTGTTATTGAGCAAGCATAGATGGGTACAGAGTAG
Features of the protein sequence |
Description | |
|---|---|---|
Length: 689 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GACTTCTAGGTACAAACTCAG | |
| : TGCAGAAAGTCCAGTGTCCAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : X |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |