HUGE |
Gene/Protein Characteristic Table for KIAA1999 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB082530 |
Description : | rapamycin-insensitive companion of mTOR. |
HUGO Gene Name : | |
Clone Name : | bf00346 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8232 bp
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | Warning for N-terminal truncation: YES | YES | Warning for coding interruption: YES | NO | |
Length of 3'UTR 4384 bp Genome contig ID gi51511721r_38873778 PolyA signal sequence
(AATAAA,-27) +----*----+----*----+----*----+----
ACATTGTTAATAAAATGTACTTAAAATTCTTAAACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TTTGTCATTGTTTTATTTGAAATCTTAAAATAATCAGTGGTCATATGGCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 r 38973778 39000752 23 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1275 aa
This protein sequence is predicted from the revised DNA sequence
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACCTGTCAGAAACCCTAAAGC | |
: ACCTCCAAATATGTAGCAGCG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |