HUGE

Gene/Protein Characteristic Table for KIAA1974

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05736
Accession No. :	AB075854
Description :
HUGO Gene Name :
Clone Name :	ah03502 [Vector Info]
Source :	Human brain (amygdala)

Features of the cloned DNA sequence	Description

Length: 5610 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2986 bp

Genome contig ID gi51511747f_56600460
PolyA signal sequence
(AGTAAA,-30)
+----*----+----*----+----*----+----
GATTCAGTAAATTGGTTGTTTTCCTGTCTGCTTCG
Flanking genome sequence
(127243 - 127292)
----+----*----+----*----+----*----+----*----+----*
AGTCCTTGCCTCAAATGAGCCTTCAACAAGATAATGCATTGAAAAGCCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 56700460 56727701 14 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 362 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG60029	1.1e-134	100.0	unnamed protein...	Homo sapiens
EAW75479	1.1e-134	100.0	aminopeptidase-...	Homo sapiens
CAH92294	1.2e-134	100.0	hypothetical pr...	Pongo abelii
Q5R7G6	1.2e-134	100.0	Probable aminop...	Pongo abelii
Q8NDH3	1.2e-134	100.0	Probable aminop...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000819 205 222 PR00481 Peptidase M17

IPR000819 227 248 PR00481 Peptidase M17

IPR000819 264 285 PR00481 Peptidase M17

IPR000819 286 306 PR00481 Peptidase M17

IPR000819 315 330 PR00481 Peptidase M17

HMMPfam IPR000819 128 328 PF00883 Peptidase M17

ScanRegExp IPR000819 290 297 PS00631 Peptidase M17

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000819	205	222	PR00481	Peptidase M17
IPR000819	227	248	PR00481	Peptidase M17
IPR000819	264	285	PR00481	Peptidase M17
IPR000819	286	306	PR00481	Peptidase M17
IPR000819	315	330	PR00481	Peptidase M17
HMMPfam	IPR000819	128	328	PF00883	Peptidase M17
ScanRegExp	IPR000819	290	297	PS00631	Peptidase M17

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GACACACCCTGCAATGAGATG

Primer_r
: TTTGCCAACCCCATAGATTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2986 bp
Genome contig ID	gi51511747f_56600460
PolyA signal sequence (AGTAAA,-30)	+--------+--------+----*----+---- GATTCAGTAAATTGGTTGTTTTCCTGTCTGCTTCG
Flanking genome sequence (127243 - 127292)	----+--------+--------+--------+--------+----* AGTCCTTGCCTCAAATGAGCCTTCAACAAGATAATGCATTGAAAAGCCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	56700460	56727701	14	99.2	Perfect prediction

Primer_f	: GACACACCCTGCAATGAGATG
Primer_r	: TTTGCCAACCCCATAGATTCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1974

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information